Tomato sRNA S23646567
| Sequence | Length | annotation |
| UGGACUGAAGGGAGCUCCCU | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1 | 0.22 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 942 | 725.92 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 56 | 42.48 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 17 | 12.11 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 249 | 183.38 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 49 | 30.6 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 230 | 146.52 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 605 | 398.73 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 607 | 371.09 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 522 | 312.48 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 69 | 67.32 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 85 | 49.62 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 6 | 5.89 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 9 | 6.37 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 1187 | 1292.17 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 1004 | 959.28 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 320 | 924.39 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 494 | 344.14 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 289 | 385.65 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 2 | 0.96 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 2 | 1.66 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 366 | 96.08 |
|