Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UGGAGAAGCAGGGCACGUGC	20	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	1624	158.25
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	1164	154.28
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	235	27.45
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	27	5.81
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	1	0.07
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	5168	2161.07
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	826	844.63
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	12410	3123.66
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	717	203.21
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	599	153.25
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	274	131.99
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	65	54
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	59	33.45
S0708	Solanum lycopersicum	MicroTom	flower, open	333	102.75
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	1013	265.94
S0373	Solanum lycopersicum	Heinz 1706	fruit	47	14.07
S0372	Solanum lycopersicum	Heinz 1706	flower	22	6.66
S0371	Solanum lycopersicum	Heinz 1706	leaf	1	0.3