Tomato sRNA S23655831
| Sequence | Length | annotation |
| UGGAGAAGCAGGGCACGUGCAA | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1 | 0.1 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 12 | 1.59 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 8 | 0.93 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 268 | 112.07 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 43 | 43.97 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 294 | 74 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 92 | 26.07 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 14 | 3.58 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 60 | 28.9 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 7 | 5.82 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 17 | 9.64 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 89 | 27.46 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 52 | 13.65 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 13 | 3.89 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 8 | 2.42 |
|