Tomato sRNA S23676315
Sequence | Length | annotation |
UGGAGGCAGCGGUUCAUCGAUC | 22 | |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 221 | 21.54 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 148 | 19.62 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 61 | 7.13 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 11 | 2.37 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 297 | 21.91 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 34 | 14.22 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 5 | 5.11 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 39 | 9.82 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 18 | 5.1 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 67 | 17.14 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 11 | 5.3 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 7 | 5.82 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 11 | 6.24 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 77 | 23.76 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 25 | 6.56 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 20 | 5.99 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 21 | 6.36 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 31 | 9.34 |
|