Tomato sRNA S23737564
Sequence | Length | annotation |
UGGCAGGAAGACAUGAGGCAUU | 22 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 2 | 0.23 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1 | 0.22 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 2 | 0.15 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 289 | 222.71 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 137 | 103.93 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 138 | 98.32 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 177 | 130.36 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 317 | 197.94 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 344 | 219.14 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 301 | 198.37 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 351 | 214.58 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 414 | 247.83 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 27 | 26.34 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 108 | 63.05 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 44 | 43.16 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 87 | 61.53 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 18 | 19.59 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 279 | 194.36 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 194 | 258.88 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 89 | 37.22 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 21 | 21.47 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 119 | 29.95 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 135 | 38.26 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 272 | 69.59 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 335 | 161.37 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 258 | 214.33 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 375 | 212.63 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 528 | 162.91 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 1101 | 289.04 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 2 | 0.6 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 17 | 5.14 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 2 | 0.6 |
S23737564 mapped to the follwoing genes
|