Tomato sRNA S23946472
| Sequence | Length | annotation |
|---|
| UGUAAGGAUAUGACACAUGAGC | 22 | |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 5 | 3.85 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 4 | 3.03 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 3 | 2.14 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 2 | 1.47 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 8 | 5 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 2 | 1.27 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 4 | 2.64 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 3 | 1.83 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 4 | 2.39 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 4 | 3.9 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 4 | 2.34 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 13 | 12.75 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 2 | 2.18 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 4 | 2.79 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 12 | 16.01 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 1 | 0.25 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 1 | 0.48 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 2 | 1.13 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 1 | 0.3 |
|
