Tomato Functional Genomics Database (TFGD)

Tomato sRNA S24047118

Sequence	Length	annotation
UGUCGCAGAUGACUUUCGCC	20	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	152	14.81
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	94	12.46
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	27	3.15
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	7	1.51
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	190	14.01
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	53	40.84
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	41	31.1
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	19	13.54
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	31	22.83
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	47	29.35
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	50	31.85
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	42	27.68
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	45	27.51
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	43	25.74
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	239	233.19
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	446	260.36
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	251	246.21
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	503	355.74
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	118	128.46
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	167	159.56
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	15	43.33
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	85	59.21
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	10	13.34
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	2	0.84
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	11	2.77
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	20	5.12
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	46	22.16
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	4	3.32
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	11	6.24
S0708	Solanum lycopersicum	MicroTom	flower, open	26	8.02
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	43	11.29
S0373	Solanum lycopersicum	Heinz 1706	fruit	31	9.28
S0372	Solanum lycopersicum	Heinz 1706	flower	29	8.78
S0371	Solanum lycopersicum	Heinz 1706	leaf	34	10.25