Tomato sRNA S24047119
| Sequence | Length | annotation |
| UGUCGCAGAUGACUUUCGCCC | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 4621 | 450.29 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 3515 | 465.9 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 288 | 33.64 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 393 | 84.63 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 3121 | 230.2 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 1447 | 1115.08 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 683 | 518.13 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 566 | 403.24 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 551 | 405.8 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 753 | 470.18 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 1157 | 737.06 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 914 | 602.37 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 943 | 576.5 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 950 | 568.68 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 6214 | 6063 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 11399 | 6654.43 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 6620 | 6493.79 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 13086 | 9254.85 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 3502 | 3812.29 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 3986 | 3808.45 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 418 | 1207.49 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 1245 | 867.32 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 269 | 358.96 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 71 | 29.69 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 9 | 9.2 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 174 | 43.8 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 48 | 13.6 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 200 | 51.17 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 180 | 86.71 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 46 | 38.21 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 61 | 34.59 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 286 | 88.24 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 564 | 148.07 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 1368 | 409.46 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 908 | 274.8 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1057 | 318.52 |
|