Tomato Functional Genomics Database (TFGD)

Tomato sRNA S24119683

Sequence	Length	annotation
UGUGGGGAAGAAGGGCAUUUUGG	23	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	2	0.19
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	10	1.33
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	8	0.93
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	3	0.65
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	48	3.54
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	79	60.88
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	18	13.65
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	47	33.48
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	53	39.03
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	51	31.84
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	48	30.58
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	64	42.18
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	60	36.68
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	77	46.09
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	37	36.1
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	27	15.76
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	23	22.56
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	44	31.12
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	24	26.13
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	11	10.51
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	3	8.67
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	19	13.24
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	42	56.05
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	23	9.62
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	3	3.07
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	91	22.91
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	167	47.33
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	54	13.82
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	113	54.43
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	278	230.95
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	474	268.76
S0708	Solanum lycopersicum	MicroTom	flower, open	32	9.87
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	67	17.59
S0372	Solanum lycopersicum	Heinz 1706	flower	1	0.3