Tomato Functional Genomics Database (TFGD)

Tomato sRNA S24119684

Sequence	Length	annotation
UGUGGGGAAGAAGGGCAUUUUGGA	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	1	0.1
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	7	0.93
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	2	0.23
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	2	0.43
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	51	3.76
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	12	9.25
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	3	2.28
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	12	8.55
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	14	10.31
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	12	7.49
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	7	4.46
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	10	6.59
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	15	9.17
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	5	2.99
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	18	17.56
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	3	1.75
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	6	5.89
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	9	6.37
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	7	7.62
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	3	2.87
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	1	2.89
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	7	4.88
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	15	20.02
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	9	3.76
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	3	3.07
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	30	7.55
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	68	19.27
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	17	4.35
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	74	35.65
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	318	264.18
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	743	421.28
S0708	Solanum lycopersicum	MicroTom	flower, open	18	5.55
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	22	5.78