Tomato Functional Genomics Database (TFGD)

Tomato sRNA S24121304

Sequence	Length	annotation
UGUGGGUGGGGUGGAAAGAUU	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	406	39.56
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	732	97.02
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	4998	583.88
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	900	193.81
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	2521	185.95
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	35	26.97
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	37	28.07
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	25	17.81
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	27	19.88
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	42	26.23
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	23	14.65
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	51	33.61
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	43	26.29
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	26	15.56
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	9	8.78
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	27	15.76
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	22	21.58
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	33	23.34
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	31	33.75
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	49	46.82
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	23	66.44
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	47	32.74
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	63	84.07
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	21	8.78
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	7	7.16
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	37	9.31
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	33	9.35
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	70	17.91
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	111	53.47
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	49	40.71
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	93	52.73
S0708	Solanum lycopersicum	MicroTom	flower, open	18	5.55
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	32	8.4
S0373	Solanum lycopersicum	Heinz 1706	fruit	6	1.8
S0372	Solanum lycopersicum	Heinz 1706	flower	7	2.12
S0371	Solanum lycopersicum	Heinz 1706	leaf	10	3.01