Tomato sRNA S24684376
| Sequence | Length | annotation |
|---|
| UUAGUAUAGUAUAAGUGUGUCUC | 23 | |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 51 | 4.97 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 14 | 1.86 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 14 | 1.64 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1 | 0.22 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 48 | 3.54 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 1 | 0.74 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 1 | 0.62 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 1 | 0.58 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 2 | 1.41 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 1 | 1.09 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 2 | 0.5 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 2 | 0.51 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 3 | 2.49 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 6 | 3.4 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 1 | 0.31 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 17 | 4.46 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 36 | 10.78 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 13 | 3.93 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 15 | 4.52 |
|
