Tomato sRNA S24684381
Sequence | Length | annotation |
UUAGUAUAGUAUAAGUGUGUCUCU | 24 | |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1105 | 107.68 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 456 | 60.44 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 93 | 10.86 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 15 | 3.23 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 346 | 25.52 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 7 | 5.39 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 5 | 3.79 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 4 | 2.95 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 8 | 5 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 10 | 6.37 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 1 | 0.66 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 7 | 4.28 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 1 | 0.6 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 4 | 3.9 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 23 | 13.43 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 11 | 10.79 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 10 | 7.07 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 12 | 13.06 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 5 | 4.78 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 1 | 2.89 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 24 | 16.72 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 2 | 2.67 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 5 | 2.09 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 7 | 1.76 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 3 | 0.85 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 14 | 3.58 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 7 | 3.37 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 5 | 4.15 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 14 | 7.94 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 6 | 1.85 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 50 | 13.13 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 230 | 68.84 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 116 | 35.11 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 87 | 26.22 |
|