Tomato Functional Genomics Database (TFGD)

Tomato sRNA S24937335

Sequence	Length	annotation
UUCAAUAAAGCUGUGGGAAG	20	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	1399	136.33
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	784	103.92
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	430	50.23
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	652	140.4
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	118	8.7
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	20	15.41
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	55	41.72
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	25	17.81
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	43	31.67
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	92	57.45
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	26	16.56
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	65	42.84
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	64	39.13
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	32	19.16
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	18	17.56
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	25	14.59
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	35	34.33
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	12	8.49
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	64	69.67
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	92	87.9
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	24	69.33
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	16	11.15
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	18	24.02
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	7	2.93
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	1	1.02
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	39	9.82
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	9	2.55
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	21	5.37
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	32	15.41
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	5	4.15
S0708	Solanum lycopersicum	MicroTom	flower, open	1	0.31
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	13	3.41
S0373	Solanum lycopersicum	Heinz 1706	fruit	106	31.73
S0372	Solanum lycopersicum	Heinz 1706	flower	42	12.71
S0371	Solanum lycopersicum	Heinz 1706	leaf	126	37.97