Tomato sRNA S25045576
| Sequence | Length | annotation |
| UUCCACAGCUUUCUUGAACU | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 576 | 56.13 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 264 | 34.99 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 830 | 96.96 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 4179 | 899.92 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 55 | 4.06 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 8 | 6.16 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 9 | 6.83 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 3 | 2.14 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 14 | 10.31 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 18 | 11.24 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 12 | 7.64 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 24 | 15.82 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 8 | 4.89 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 5 | 2.99 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 24 | 23.42 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 27 | 15.76 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 35 | 34.33 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 29 | 20.51 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 17 | 18.51 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 18 | 17.2 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 5 | 14.44 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 9 | 6.27 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 5 | 6.67 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 8 | 3.35 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 6 | 6.14 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 11 | 2.77 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 14 | 3.97 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 34 | 8.7 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 36 | 17.34 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 6 | 4.98 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 12 | 6.8 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 27 | 8.33 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 20 | 5.25 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 23 | 6.88 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 21 | 6.36 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 19 | 5.73 |
|