Tomato sRNA S25045577
Sequence | Length | annotation |
UUCCACAGCUUUCUUGAACUG | 21 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 8555 | 833.64 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 3913 | 518.65 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 442097 | 51646.7 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 65614 | 14129.5 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1379 | 101.71 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 110 | 84.77 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 129 | 97.86 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 49 | 34.91 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 56 | 41.24 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 128 | 79.92 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 78 | 49.69 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 139 | 91.61 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 163 | 99.65 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 83 | 49.68 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 187 | 182.46 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 282 | 164.62 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 210 | 206 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 182 | 128.72 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 167 | 181.8 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 183 | 174.85 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 49 | 141.55 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 69 | 48.07 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 48 | 64.05 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 22 | 9.2 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 10 | 10.23 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 115 | 28.95 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 30 | 8.5 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 233 | 59.61 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 38 | 18.3 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 16 | 13.29 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 2 | 1.13 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 67 | 20.67 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 60 | 15.75 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 4329 | 1295.73 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 608 | 184.01 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1538 | 463.46 |
|