Tomato sRNA S25045581
Sequence | Length | annotation |
UUCCACAGCUUUCUUGAACUU | 21 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1088 | 106.02 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 482 | 63.89 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 9616 | 1123.36 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 7772 | 1673.65 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 389 | 28.69 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 123 | 94.79 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 140 | 106.2 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 81 | 57.71 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 78 | 57.45 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 267 | 166.72 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 166 | 105.75 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 186 | 122.58 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 139 | 84.98 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 88 | 52.68 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 356 | 347.35 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 597 | 348.51 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 584 | 572.87 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 567 | 401 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 344 | 374.48 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 372 | 355.43 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 87 | 251.32 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 289 | 201.33 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 124 | 165.47 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 10 | 4.18 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 12 | 12.27 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 55 | 13.84 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 28 | 7.94 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 98 | 25.07 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 42 | 20.23 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 5 | 4.15 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 11 | 6.24 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 39 | 12.03 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 236 | 61.96 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 432 | 129.3 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 402 | 121.66 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 376 | 113.3 |
|