Tomato sRNA S25120647
| Sequence | Length | annotation |
| UUCGGACAUAGGUUGAGAGGGUA | 23 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 9 | 0.88 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 11 | 1.29 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 3 | 0.65 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 21 | 1.55 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 396 | 305.16 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 332 | 251.86 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 197 | 140.35 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 223 | 164.23 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 393 | 245.39 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 358 | 228.06 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 452 | 297.89 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 734 | 448.73 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 621 | 371.74 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 104 | 101.47 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 174 | 101.58 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 109 | 106.92 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 81 | 57.29 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 155 | 168.73 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 100 | 95.55 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 16 | 46.22 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 329 | 229.19 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 203 | 270.89 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 87 | 36.38 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 59 | 60.33 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 183 | 46.06 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 353 | 100.05 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 174 | 44.52 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 92 | 44.32 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 66 | 54.83 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 29 | 16.44 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 91 | 28.08 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 58 | 15.23 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 5 | 1.5 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 1 | 0.3 |
|