Tomato sRNA S25121238
Sequence | Length | annotation |
UUCGGACCAGGCUUCAUUCCC | 21 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 23 | 2.24 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 13 | 1.72 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 126 | 14.72 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 941 | 202.64 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 5489 | 404.87 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 371 | 285.9 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 270 | 204.82 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 177 | 126.1 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 156 | 114.89 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 366 | 228.53 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 248 | 157.99 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 250 | 164.76 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 333 | 203.58 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 322 | 192.75 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 320 | 312.22 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 849 | 495.62 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 333 | 326.65 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 1154 | 816.15 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 482 | 524.71 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 585 | 558.94 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 263 | 759.74 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 136 | 94.74 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 229 | 305.59 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 71 | 29.69 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 20 | 20.45 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 390 | 98.16 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 42 | 11.9 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 394 | 100.8 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 106 | 51.06 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 40 | 33.23 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 30 | 17.01 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 484 | 149.34 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 332 | 87.16 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 1226 | 366.96 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 1355 | 410.08 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 3077 | 927.23 |
|