Tomato Functional Genomics Database (TFGD)

Tomato sRNA S25121239

Sequence	Length	annotation
UUCGGACCAGGCUUCAUUCCCC	22	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	1	0.1
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	8	0.93
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	74	15.94
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	204	15.05
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	17	13.1
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	23	17.45
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	13	9.26
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	6	4.42
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	15	9.37
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	18	11.47
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	19	12.52
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	13	7.95
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	12	7.18
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	27	26.34
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	95	55.46
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	37	36.29
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	107	75.67
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	60	65.32
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	80	76.44
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	52	150.21
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	9	6.27
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	43	57.38
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	7	2.93
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	4	4.09
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	35	8.81
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	14	3.97
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	60	15.35
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	9	4.34
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	7	5.82
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	3	1.7
S0708	Solanum lycopersicum	MicroTom	flower, open	155	47.82
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	30	7.88
S0373	Solanum lycopersicum	Heinz 1706	fruit	48	14.37
S0372	Solanum lycopersicum	Heinz 1706	flower	104	31.47
S0371	Solanum lycopersicum	Heinz 1706	leaf	114	34.35