Tomato sRNA S25121239
| Sequence | Length | annotation |
| UUCGGACCAGGCUUCAUUCCCC | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1 | 0.1 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 8 | 0.93 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 74 | 15.94 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 204 | 15.05 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 17 | 13.1 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 23 | 17.45 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 13 | 9.26 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 6 | 4.42 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 15 | 9.37 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 18 | 11.47 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 19 | 12.52 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 13 | 7.95 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 12 | 7.18 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 27 | 26.34 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 95 | 55.46 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 37 | 36.29 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 107 | 75.67 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 60 | 65.32 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 80 | 76.44 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 52 | 150.21 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 9 | 6.27 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 43 | 57.38 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 7 | 2.93 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 4 | 4.09 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 35 | 8.81 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 14 | 3.97 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 60 | 15.35 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 9 | 4.34 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 7 | 5.82 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 3 | 1.7 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 155 | 47.82 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 30 | 7.88 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 48 | 14.37 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 104 | 31.47 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 114 | 34.35 |
|