Tomato sRNA S25243999
Sequence | Length | annotation |
UUCUUGGCUAGAGUUGUAUUGC | 22 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 3527 | 343.69 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1573 | 208.49 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 649 | 75.82 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 446 | 96.04 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 140 | 10.33 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 14 | 5.85 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 19 | 4.78 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 11 | 3.12 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 16 | 4.09 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 1 | 0.48 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 3 | 2.49 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 10 | 3.09 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 3 | 0.79 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 121 | 36.22 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 40 | 12.11 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 48 | 14.46 |
|