Tomato sRNA S25581452
| Sequence | Length | annotation |
|---|
| UUGGACUGAAGGGAGCUCCC | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 7 | 0.82 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 83 | 17.87 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 400 | 308.25 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 33 | 25.03 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 9 | 6.41 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 75 | 55.24 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 31 | 19.36 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 186 | 118.49 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 240 | 158.17 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 221 | 135.11 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 289 | 173 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 17 | 16.59 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 28 | 16.35 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 7 | 6.87 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 9 | 6.37 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 225 | 244.94 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 114 | 108.92 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 83 | 239.76 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 78 | 54.34 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 97 | 129.44 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 5 | 1.26 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 9 | 4.34 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 17 | 9.64 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 13 | 4.01 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 352 | 92.41 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 1 | 0.3 |
|
