Tomato sRNA S25581453
Sequence | Length | annotation |
UUGGACUGAAGGGAGCUCCCU | 21 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 8 | 0.93 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 22 | 4.74 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1 | 0.07 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 8551 | 6589.53 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 423 | 320.89 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 131 | 93.33 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 1261 | 928.7 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 477 | 297.84 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 1848 | 1177.25 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 3615 | 2382.47 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 3849 | 2353.07 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 4436 | 2655.45 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 266 | 259.54 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 646 | 377.12 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 104 | 102.02 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 55 | 38.9 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 6048 | 6583.87 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 3971 | 3794.12 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 2262 | 6534.31 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 2082 | 1450.41 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 2513 | 3353.43 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 20 | 8.36 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 1 | 1.02 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 60 | 15.1 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 25 | 7.09 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 26 | 6.65 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 87 | 41.91 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 34 | 28.25 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 58 | 32.89 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 21 | 6.48 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 6885 | 1807.5 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 8 | 2.42 |
|