Tomato sRNA S25581462
| Sequence | Length | annotation |
| UUGGACUGAAGGGAGCUCCUU | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 24 | 2.34 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 19 | 2.52 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1142 | 133.41 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 2394 | 515.53 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 2 | 0.15 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 3 | 1.25 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 13 | 3.27 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 6 | 1.7 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 12 | 3.07 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 151 | 72.74 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 42 | 34.89 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 72 | 40.82 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 16 | 4.94 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 188 | 49.36 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 1 | 0.3 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 2 | 0.61 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 3 | 0.9 |
|