Tomato sRNA S25628347
| Sequence | Length | annotation |
| UUGGCUGAGUGAGCAUCACG | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1346 | 131.16 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 550 | 72.9 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 683 | 79.79 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 363 | 78.17 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 89 | 6.56 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 92 | 38.47 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 70 | 71.58 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 59 | 14.85 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 189 | 53.57 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 126 | 32.24 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 76 | 36.61 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 16 | 13.29 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 22 | 12.47 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 47 | 14.5 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 40 | 10.5 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 361 | 108.05 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 127 | 38.44 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 228 | 68.71 |
|