Tomato sRNA S25628348
| Sequence | Length | annotation |
| UUGGCUGAGUGAGCAUCACGG | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 24295 | 2367.42 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 8219 | 1089.39 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 5341 | 623.95 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 11178 | 2407.1 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 75224 | 5548.51 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 3508 | 1466.92 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 185 | 189.17 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 3038 | 764.68 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 1741 | 493.44 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 4830 | 1235.71 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 1308 | 630.06 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 442 | 367.19 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 387 | 219.43 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 1995 | 615.55 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 1146 | 300.86 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 81477 | 24387.2 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 25220 | 7632.62 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 56940 | 17158.4 |
|