Tomato sRNA S25628350
Sequence | Length | annotation |
UUGGCUGAGUGAGCAUCACGGAA | 23 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 20 | 1.48 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 1 | 0.25 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 4 | 1.13 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 2 | 0.51 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 2 | 0.96 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 8 | 2.47 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 2 | 0.53 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 390 | 116.73 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 130 | 39.34 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 423 | 127.47 |
|