Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UUGGCUGAGUGAGCAUCACUG	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	3578	348.66
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	1172	155.34
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	3377	394.51
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	1354	291.57
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	5546	409.07
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	140	58.54
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	24	24.54
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	146	36.75
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	52	14.74
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	278	71.12
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	107	51.54
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	37	30.74
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	64	36.29
S0708	Solanum lycopersicum	MicroTom	flower, open	62	19.13
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	169	44.37
S0373	Solanum lycopersicum	Heinz 1706	fruit	21967	6575.03
S0372	Solanum lycopersicum	Heinz 1706	flower	8524	2579.72
S0371	Solanum lycopersicum	Heinz 1706	leaf	21261	6406.82