Tomato sRNA S26186096
Sequence | Length | annotation |
UUUCGGACAUAGGUUGAGAGGGUA | 24 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 2 | 0.19 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 2 | 0.27 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 6 | 0.7 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 10 | 2.15 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 144 | 10.62 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 340 | 262.01 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 298 | 226.06 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 279 | 198.77 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 243 | 178.96 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 291 | 181.7 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 309 | 196.85 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 314 | 206.94 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 680 | 415.72 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 416 | 249.02 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 44 | 42.93 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 91 | 53.12 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 31 | 30.41 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 47 | 33.24 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 117 | 127.37 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 78 | 74.53 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 9 | 26 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 354 | 246.61 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 110 | 146.79 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 40 | 16.73 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 43 | 43.97 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 98 | 24.67 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 168 | 47.62 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 126 | 32.24 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 88 | 42.39 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 35 | 29.08 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 27 | 15.31 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 127 | 39.19 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 61 | 16.01 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 10 | 2.99 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 7 | 2.12 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 9 | 2.71 |
|