Tomato Functional Genomics Database (TFGD)

Tomato sRNA S26186096

Sequence	Length	annotation
UUUCGGACAUAGGUUGAGAGGGUA	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	2	0.19
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	2	0.27
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	6	0.7
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	10	2.15
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	144	10.62
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	340	262.01
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	298	226.06
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	279	198.77
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	243	178.96
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	291	181.7
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	309	196.85
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	314	206.94
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	680	415.72
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	416	249.02
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	44	42.93
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	91	53.12
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	31	30.41
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	47	33.24
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	117	127.37
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	78	74.53
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	9	26
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	354	246.61
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	110	146.79
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	40	16.73
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	43	43.97
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	98	24.67
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	168	47.62
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	126	32.24
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	88	42.39
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	35	29.08
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	27	15.31
S0708	Solanum lycopersicum	MicroTom	flower, open	127	39.19
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	61	16.01
S0373	Solanum lycopersicum	Heinz 1706	fruit	10	2.99
S0372	Solanum lycopersicum	Heinz 1706	flower	7	2.12
S0371	Solanum lycopersicum	Heinz 1706	leaf	9	2.71