Tomato sRNA S26186508
Sequence | Length | annotation |
UUUCGGACCAGGCUUCAUUCCC | 22 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1 | 0.1 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 3 | 0.35 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 66 | 14.21 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 697 | 51.41 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 68 | 52.4 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 27 | 20.48 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 9 | 6.41 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 26 | 19.15 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 40 | 24.98 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 31 | 19.75 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 36 | 23.73 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 33 | 20.17 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 37 | 22.15 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 13 | 12.68 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 28 | 16.35 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 17 | 16.68 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 23 | 16.27 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 44 | 47.9 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 29 | 27.71 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 15 | 43.33 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 26 | 18.11 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 46 | 61.38 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 22 | 9.2 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 3 | 3.07 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 33 | 8.31 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 1 | 0.28 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 25 | 6.4 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 8 | 3.85 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 2 | 1.66 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 20 | 11.34 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 695 | 214.44 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 75 | 19.69 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 38 | 11.37 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 357 | 108.04 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 25 | 7.53 |
|