Tomato sRNA S26383701
| Sequence | Length | annotation |
| UUUGGACGGCAUGAACACUAAUGU | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 9 | 0.88 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 6 | 0.8 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 6 | 1.29 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 23 | 1.7 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 417 | 174.37 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 778 | 795.54 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 466 | 117.29 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 1429 | 405.01 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 678 | 173.46 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 206 | 99.23 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 139 | 115.47 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 228 | 129.28 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 472 | 145.63 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 956 | 250.98 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 4 | 1.21 |
|