Tomato sRNA S26397462
| Sequence | Length | annotation |
| UUUGGAUUGAAGGGAGCUCUA | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 6735 | 656.29 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 3502 | 464.17 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 32314 | 3774.99 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 18011 | 3878.54 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1160 | 85.56 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 302 | 126.29 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 206 | 210.65 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 1249 | 314.38 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 353 | 100.05 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 545 | 139.43 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 3507 | 1689.32 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 2634 | 2188.17 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 4679 | 2653.01 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 781 | 240.97 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 1988 | 521.9 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 1013 | 303.21 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 467 | 141.33 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 974 | 293.51 |
|