Tomato sRNA S26404271
| Sequence | Length | annotation |
|---|
| UUUGGCUCAUGGAUUUUAGC | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 7762 | 756.37 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 661 | 87.61 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1166 | 136.21 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 2012 | 433.27 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 10 | 0.74 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 5 | 3.85 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 2 | 1.52 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 8 | 5.7 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 5 | 3.12 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 3 | 1.91 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 3 | 1.98 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 4 | 2.45 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 6 | 3.59 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 2 | 1.17 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 3 | 2.94 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 5 | 3.54 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 5 | 5.44 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 4 | 3.82 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 2 | 5.78 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 8 | 5.57 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 4 | 1.67 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 5 | 1.26 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 3 | 0.85 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 4 | 1.02 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 3 | 1.45 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 1 | 0.57 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 48 | 14.37 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 19 | 5.75 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 10 | 3.01 |
|
