Tomato miRNA M00010
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1 |
0.1 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
88 |
6.49 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
2 |
1.54 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
4 |
3.03 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
1 |
0.71 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
4 |
2.95 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
5 |
3.12 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
5 |
3.19 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
4 |
2.64 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
4 |
2.45 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
2 |
1.2 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
236 |
230.27 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
126 |
73.56 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
202 |
198.15 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
115 |
81.33 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
197 |
214.45 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
288 |
275.17 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
235 |
678.85 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
4 |
2.79 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
6 |
8.01 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
9 |
3.76 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
7 |
1.76 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
1 |
0.26 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
3 |
0.9 |
Hits on known miRNAs
| hit miRNA | alignment |
|---|
| cme-miR156j | -CTGACAGAAGAGAGTGAGCAC xx|||||||||||||||||||| GTTGACAGAAGAGAGTGAGCAC | | gma-miR156k | CTGACAGAAGAGAGTGAGCAC x|||||||||||||||||||| TTGACAGAAGAGAGTGAGCAC | | gma-miR156n | CTGACAGAAGAGAGTGAGCAC x|||||||||||||||||||| TTGACAGAAGAGAGTGAGCAC | | gma-miR156o | CTGACAGAAGAGAGTGAGCAC x|||||||||||||||||||| TTGACAGAAGAGAGTGAGCAC | Precursor of miRNA M00010
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch07 |
324086 |
324173 |
+ |
CUGACAGAAGAGAGUGAGCA
CACGAUGUCAAAUUGUAUAA
AUAUAUAUACAAUUGUCAUU
UGCGUGUGCUCACUUCUCAU
UCUGUCAG |
-47.30 |
NA |
structure |
|