Tomato miRNA M00012
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
6 |
0.58 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
2 |
0.27 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
6 |
0.7 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
20 |
4.31 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1008 |
74.35 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
7 |
2.93 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
2 |
2.05 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
16 |
4.03 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
2 |
0.57 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
36 |
9.21 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
16 |
7.71 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
1 |
0.83 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
9 |
5.1 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
25 |
7.71 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
121 |
31.77 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
16 |
4.79 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
55 |
16.65 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
442 |
133.19 |
Hits on known miRNAs
| hit miRNA | alignment |
|---|
| gma-miR156f | TTGACAGAAGATAGAGAGCACT |||||||||||x|||||||||x TTGACAGAAGAGAGAGAGCACA | Precursor of miRNA M00012
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch06 |
39241775 |
39241676 |
- |
UUGACAGAAGAUAGAGAGCA
CUAAUGAUGAUAUGCUAAUU
UCAUUCAAUUUGGGCAGCAA
AAGCAUCUCAAUUCAUUUGU
GCUCUCUAUGCUUCUGUCAU
|
-43.44 |
NA |
structure |
|