Tomato miRNA M00020
| sequence | Length | miRNA family | sRNA ID | target |
| GGAGGCAGCGGUUCAUCGAUC | 21 | miR162 |
S17879556 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
685 |
66.75 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1217 |
161.31 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
819 |
95.68 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
6 |
1.29 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
69 |
5.09 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
8 |
3.35 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
10 |
2.52 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
1 |
0.28 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
14 |
3.58 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
31 |
14.93 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
33 |
27.41 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
19 |
10.77 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
105 |
32.4 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
44 |
11.55 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
3 |
0.9 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
7 |
2.12 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
6 |
1.81 |
Hits on known miRNAs
| hit miRNA | alignment |
|---|
| aly-miR162a-5p | GGAGGCAGCGGTTCATCGATC ||||||||||||||||||||| GGAGGCAGCGGTTCATCGATC | | aly-miR162b-5p | GGAGGCAGCGGTTCATCGATC ||||||||||||||||||||| GGAGGCAGCGGTTCATCGATC | | csi-miR162-5p | -GGAGGCAGCGGTTCATCGATC x||||||||||||||||||||| TGGAGGCAGCGGTTCATCGATC | Precursor of miRNA M00020
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch03 |
58491545 |
58491623 |
+ |
GGAGGCAGCGGUUCAUCGAU
CUGUUCCCUGAAAAGCGAUA
AAUACAGCAACAGGAAGCGA
UCGAUAAACCUCUGCAUCC |
-32.90 |
NA |
structure |
| SL2.40ch06 |
39463120 |
39463213 |
+ |
GGAGGCAGCGGUUCAUCGAU
CCGUUCCCUGGAAGCUGAAU
AUAUAUAUACGCAAAAAUAC
AGCAAAAGGAAUCGGUCGAU
AAACCUCUGCAUCC |
-32.85 |
NA |
structure |
|