Tomato miRNA M00056
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
55 |
5.36 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
28 |
3.71 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
252 |
29.44 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
111 |
23.9 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
29 |
2.14 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
3 |
2.31 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
2 |
1.52 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
3 |
2.14 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
3 |
2.21 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
13 |
8.12 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
3 |
1.91 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
5 |
3.3 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
3 |
1.83 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
3 |
1.8 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
8 |
7.81 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
3 |
1.75 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
2 |
1.96 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
6 |
4.24 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
17 |
18.51 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
10 |
9.55 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
2 |
5.78 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
9 |
6.27 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
3 |
4 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
1 |
0.42 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
3 |
3.07 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
10 |
2.52 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
5 |
1.28 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
248 |
119.46 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
94 |
78.09 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
4 |
2.27 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
4 |
1.23 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
9 |
2.36 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1 |
0.3 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
4 |
1.21 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1 |
0.3 |
Hits on known miRNAs
| hit miRNA | alignment |
|---|
| aly-miR396a-3p | GTTCAATAAAGCTGTGGGAA- ||||||||||||||||||||x GTTCAATAAAGCTGTGGGAAG | | gma-miR396i-3p | GTTCAATAAAGCTGTGGGAA- ||||||||||||||||||||x GTTCAATAAAGCTGTGGGAAG | | osa-miR396a-3p | GTTCAATAAAGCTGTGGGAA |||||||||||||||||||| GTTCAATAAAGCTGTGGGAA | | osa-miR396b-3p | GTTCAATAAAGCTGTGGGAA |||||||||||||||||||| GTTCAATAAAGCTGTGGGAA | | zma-miR396a-3p | GTTCAATAAAGCTGTGGGAA- ||||||||||||||||||||x GTTCAATAAAGCTGTGGGAAA | | zma-miR396b-3p | GTTCAATAAAGCTGTGGGAA- ||||||||||||||||||||x GTTCAATAAAGCTGTGGGAAA | Precursor of miRNA M00056
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch00 |
12537519 |
12537618 |
+ |
UUUCCACAGCUUUCUUGAAC
UGCAUCUACAAUUUCAAUUC
AUUAUUGAAAAAGAAAAAAU
UGAUUCAUAUUGUUGUUGCG
GUUCAAUAAAGCUGUGGGAA
|
-41.30 |
miRNA* |
structure |
| SL2.40ch12 |
2905791 |
2905660 |
- |
UUUCCACAGCUUUCUUGAAC
UGCAUACAUAUAACAAAAAA
AUCUGAUUUUUUUUUGAUUU
UUUUUUACUUUUAUAAAGAA
AAAAUUUAGAUGGAAAGAAU
UAAAUUGUUGCGGUUCAAUA
AAGCUGUGGGAA |
-43.20 |
miRNA* |
structure |
|