TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00064

sequenceLengthmiRNA familysRNA IDtarget
UUCCACAGCUUUCUUGAACUUC22miR396 S25045582click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 20 1.95
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 9 1.19
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 116 13.55
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 653 140.62
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 69 5.09
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 10 7.71
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 9 6.83
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 9 6.41
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 9 6.63
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 15 9.37
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 22 14.01
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 17 11.2
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 12 7.34
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 7 4.19
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 57 55.61
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 70 40.86
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 80 78.47
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 71 50.21
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 42 45.72
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 53 50.64
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 15 43.33
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 46 32.05
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 16 21.35
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 2 0.84
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 6 1.51
S0712 Solanum lycopersicum MicroTom fruit , mature green 15 3.84
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 5 2.41
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 1 0.83
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 1 0.57
S0708 Solanum lycopersicum MicroTom flower, open 2 0.62
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 14 3.68
S0373 Solanum lycopersicum Heinz 1706 fruit 35 10.48
S0372 Solanum lycopersicum Heinz 1706 flower 82 24.82
S0371 Solanum lycopersicum Heinz 1706 leaf 52 15.67

Hits on known miRNAs

hit miRNAalignment
gma-miR396eTTCCACAGCTTTCTTGAACTTC
||||||||||||||||||||xx
TTCCACAGCTTTCTTGAACTGT

Precursor of miRNA M00064

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch07 2628873 2628773 - UUCCACAGCUUUCUUGAACU
UC
UUCUUGCUAAAUUUUGAU
CUCUAAAUUGAUAAUUUUGA
GAUGAGAUUUGAAGCUAUGA
AAGUCCAAGAAAGCUGUGGG
A
-40.20 NA structure