Tomato miRNA M00066
| sequence | Length | miRNA family | sRNA ID | target |
| UACGCAGGAGAGAUGAUGCUGG | 22 | miR4376 |
S20850098 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
12 |
1.17 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
65 |
8.62 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
9 |
1.05 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
2 |
0.43 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1092 |
80.55 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
8 |
2.05 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
2 |
0.96 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
1 |
0.57 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
92 |
28.39 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
73 |
19.16 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
51 |
15.27 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
178 |
53.87 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
735 |
221.49 |
Hits on known miRNAs
| hit miRNA | alignment |
|---|
| gma-miR4376-5p | TACGCAGGAGAGATGATGCTGG ||||||||||||||||x||||x TACGCAGGAGAGATGACGCTGT | Precursor of miRNA M00066
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch06 |
4541889 |
4541962 |
+ |
UACGCAGGAGAGAUGAUGCU
GGACGAUAGAGAAAAUGGGA
UUUAAUUUAUUGGCCAGCAU
CAUACUCCUGCAUA |
-36.50 |
NA |
structure |
|