 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00068
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| UGUGAAUGAUGCGGGAGAUAA | 21 | miR4414 | S24071129 | click here |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 3 | 0.29 |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 |
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 |
| S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 2 | 0.43 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 7 | 0.52 |
| S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 10 | 4.18 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 30 | 7.55 |
| S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 3 | 0.85 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 30 | 7.68 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 5 | 2.41 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 3 | 2.49 |
| S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 4 | 2.27 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 1377 | 424.87 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 108 | 28.35 |
| S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 17 | 5.09 |
| S0372 | Solanum lycopersicum | Heinz 1706 | flower | 225 | 68.09 |
| S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 20 | 6.03 |
Hits on known miRNAs
| hit miRNA | alignment |
|---|---|
| mtr-miR4414b | TGTGAATGATGCGGGAGATAA |||||||||||||||||x||| TGTGAATGATGCGGGAGCTAA |
Precursor of miRNA M00068
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch06 | 1551779 | 1551861 | + | UAUCUCCCGACUCAUUCAUU CAAACGCAAUAGGAAGUAUG UAAUCUUAUACUAUUGUGAA UGUGUGAAUGAUGCGGGAGA UAA |
-37.60 | NA | structure |
