TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00069

sequenceLengthmiRNA familysRNA IDtarget
UCUUUCCUACUCCUCCCAUACC22miR482 S22848265click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 1498 145.97
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 1253 166.08
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 2692 314.49
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 3887 837.04
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 1760 129.82
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 361 278.19
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 275 208.62
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 175 124.68
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 134 98.69
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 391 244.14
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 289 184.11
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 255 168.06
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 221 135.11
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 142 85
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 456 444.92
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 1218 711.04
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 543 532.65
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 879 621.66
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 317 345.09
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 429 409.89
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 240 693.29
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 632 440.28
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 279 372.31
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 2 0.84
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 4 4.09
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 48 12.08
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 10 2.83
S0712 Solanum lycopersicum MicroTom fruit , mature green 18 4.61
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 9 4.34
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 8 6.65
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 7 3.97
S0708 Solanum lycopersicum MicroTom flower, open 16 4.94
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 45 11.81
S0373 Solanum lycopersicum Heinz 1706 fruit 93 27.84
S0372 Solanum lycopersicum Heinz 1706 flower 65 19.67
S0371 Solanum lycopersicum Heinz 1706 leaf 73 22

Hits on known miRNAs

hit miRNAalignment
ghr-miR482aTCTTTCCTACTCCTCCCATACC
||||||||||||||||||||||
TCTTTCCTACTCCTCCCATACC

Precursor of miRNA M00069

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy		miRNA*structure
SL2.40ch04 55142265 55142338 + GGUUGUGGGUGGGGUGGAAA
GAUUUGAUAAAUCUAAUUUU
AAAGAGAUUAAAUCUUUCCU
ACUCCUCCCAUACC		 -36.30 NA structure