Tomato miRNA M00071
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
14381 |
1401.35 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
17846 |
2365.4 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
15829 |
1849.18 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1636 |
352.3 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
54714 |
4035.7 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
797 |
333.28 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
67 |
68.51 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
590 |
148.51 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
176 |
49.88 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
246 |
62.94 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
71 |
34.2 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
57 |
47.35 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
80 |
45.36 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
107 |
33.01 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
190 |
49.88 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
18627 |
5575.32 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
4350 |
1316.49 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
15496 |
4669.59 |
Hits on known miRNAs
| hit miRNA | alignment |
|---|
| sly-miR6022 | TGGAAGGGAGAATATCCAGGA ||||||||||||||||||||| TGGAAGGGAGAATATCCAGGA | | stu-miR6022 | TGGAAGGGAGAATATCCAGGA ||||||||||||||||||||| TGGAAGGGAGAATATCCAGGA | Precursor of miRNA M00071
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch11 |
3158695 |
3158905 |
+ |
UCCUGGAUAUUAUCCUUUCC
AUCACUAACUUAUUUCGGCU
CAAAGUUUUAAGUUGCAAGG
UACUCUUCCUAAGUCAAUUC
AAAACUUCAUGAACCUAACG
CGACUUGAUCUUAAGUUACA
UUUUACGAAACCUCAAUCUU
GGGUAGAGGACCGUGCAAUU
GGUUAAAACUCGGUCUAAAU
AACUUAGUGAUGGAAGGGAG
AAUAUCCAGGA |
-84.70 |
NA |
structure |
|