Tomato miRNA M00073
Digital expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
18014 |
1755.37 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
19549 |
2591.13 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
597 |
69.74 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
533 |
114.78 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1520 |
112.12 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
1 |
0.42 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
13 |
3.27 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
3 |
0.77 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
1 |
0.48 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
3 |
2.49 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
5 |
2.84 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
70 |
21.6 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
7 |
1.84 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
210 |
62.86 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
204 |
61.74 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
390 |
117.52 |
Hits on known miRNAs
| hit miRNA | alignment |
|---|
| sly-miR6024 | TTTTAGCAAGAGTTGTTTTACC
||||||||||||||||||||||
TTTTAGCAAGAGTTGTTTTACC | Precursor of miRNA M00073
| genome hit of precursor | precursor |
|---|
| sequence ID | start | end | strand |
sequence | folding
energy | miRNA* | structure |
|---|
| SL2.40ch01 |
74999812 |
74999734 |
- |
GGAGAAACAACACUUGCUAA
AGGAAGUUCACCAGUCAUCU
CUUUUCUUUUGGAGUUUUUU
UAGCAAGAGUUGUUUUACC |
-29.10 |
NA |
structure |
|
