Tomato miRNA M00075
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
130 |
12.67 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
68 |
9.01 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
298 |
34.81 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
129 |
27.78 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
5991 |
441.9 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
23 |
9.62 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
16 |
16.36 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
171 |
43.04 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
44 |
12.47 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
202 |
51.68 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
222 |
106.94 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
66 |
54.83 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
240 |
136.08 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
392 |
120.95 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
195 |
51.19 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
482 |
144.27 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
244 |
73.84 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
230 |
69.31 |
Hits on known miRNAs
| hit miRNA | alignment |
|---|
| sly-miR6027 | TGAATCCTTCGGCTATCCATA- |||||||||||||||||||||x TGAATCCTTCGGCTATCCATAA | | stu-miR6027 | TGAATCCTTCGGCTATCCATA- |||||||||||||||||||||x TGAATCCTTCGGCTATCCATAA | Precursor of miRNA M00075
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch10 |
62182532 |
62182654 |
+ |
UAUGGGUAGCACAAGGAUUA
AUGUGAAACAGAAAAGUGAU
AUGCAAAGAAGAUGGAGAUU
CAAUUGUUUAUUGUUACGAA
GAAAACACUUUUGUGUUUCU
CGUGAAUCCUUCGGCUAUCC
AUA |
-43.50 |
miRNA* |
structure |
|