Tomato miRNA M00078
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
30 |
2.92 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
9 |
1.19 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
14 |
1.64 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1 |
0.22 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
57 |
4.2 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
32 |
13.38 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
7 |
7.16 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
24 |
6.04 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
43 |
12.19 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
35 |
8.95 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
105 |
50.58 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
20 |
16.61 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
33 |
18.71 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
4 |
1.23 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
45 |
11.81 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
890 |
266.39 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
341 |
103.2 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
899 |
270.91 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00078
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch12 |
1977864 |
1977759 |
- |
CAGGUGCUCACUCAGCUAAU
AGUUAUUAUUUAAGAAACUC
AAUAAUAUUGGCAGCAAGGA
GAAUGGUGACUUUCAGGAUG
AUAACUAUUGGCUGAGUGAG
CAUCAC |
-50.60 |
miRNA* |
structure |
| SL2.40ch12 |
1979509 |
1979404 |
- |
GAGGUGCUCACUCAGCUAAU
AGUUAUUGUUUAAGAAACUC
AAUAAUAUUGGCAGCAAGGA
GAAUGGUGACUUUCAGGAUG
AUAACUAUUGGCUGAGUGAG
CAUCAC |
-49.70 |
miRNA* |
structure |
|