Tomato Functional Genomics Database (TFGD)

sequence	Length	miRNA family	sRNA ID	target
UUGGCUGAGUGAGCAUCACG	20	NA	S25628347	click here

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	1346	131.16
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	550	72.9
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	683	79.79
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	363	78.17
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	89	6.56
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	92	38.47
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	70	71.58
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	59	14.85
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	189	53.57
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	126	32.24
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	76	36.61
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	16	13.29
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	22	12.47
S0708	Solanum lycopersicum	MicroTom	flower, open	47	14.5
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	40	10.5
S0373	Solanum lycopersicum	Heinz 1706	fruit	361	108.05
S0372	Solanum lycopersicum	Heinz 1706	flower	127	38.44
S0371	Solanum lycopersicum	Heinz 1706	leaf	228	68.71

No hits on known miRNAs were found

genome hit of precursor				precursor
sequence ID	start	end	strand	sequence	folding energy	miRNA*	structure
SL2.40ch12	1977865	1977758	-	UCAGGUGCUCACUCAGCUAA UAGUUAUUAUUUAAGAAACU CAAUAAUAUUGGCAGCAAGG AGAAUGGUGACUUUCAGGAU GAUAACUAUUGGCUGAGUGA GCAUCACG	-50.60	miRNA*	structure