 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00083
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| UGUCGCAGAUGACUUUCGCC | 20 | NA | S24047118 | click here |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 152 | 14.81 |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 94 | 12.46 |
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 27 | 3.15 |
| S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 7 | 1.51 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 190 | 14.01 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 53 | 40.84 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 41 | 31.1 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 19 | 13.54 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 31 | 22.83 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 47 | 29.35 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 50 | 31.85 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 42 | 27.68 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 45 | 27.51 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 43 | 25.74 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 239 | 233.19 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 446 | 260.36 |
| S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 251 | 246.21 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 503 | 355.74 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 118 | 128.46 |
| S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 167 | 159.56 |
| S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 15 | 43.33 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 85 | 59.21 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 10 | 13.34 |
| S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 2 | 0.84 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 11 | 2.77 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 20 | 5.12 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 46 | 22.16 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 4 | 3.32 |
| S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 11 | 6.24 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 26 | 8.02 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 43 | 11.29 |
| S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 31 | 9.28 |
| S0372 | Solanum lycopersicum | Heinz 1706 | flower | 29 | 8.78 |
| S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 34 | 10.25 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00083
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch08 | 53776411 | 53776495 | + | UGUCGCAGAUGACUUUCGCC CAUUUAUAGAACCACACUUU CUUUAAUUUGAAUUCUAUGU GGUAGGACGAGAGUCAUCUG UGACA |
-37.30 | NA | structure |
| SL2.40ch12 | 6988968 | 6988874 | - | UGUCGCAGAUGACUUUCGCC CUUCUAAGGAACCACACUUU CUGUAAAUCUAAUUAAUUUG AAUUCAAUGUGGCAGGACGA GAGUCAUCUGUGACA |
-37.34 | NA | structure |
