Tomato miRNA M00084
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
21 |
1.55 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
34 |
26.2 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
9 |
6.83 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
15 |
10.69 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
27 |
19.88 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
40 |
24.98 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
20 |
12.74 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
22 |
14.5 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
27 |
16.51 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
25 |
14.97 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
6 |
5.85 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
9 |
5.25 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
8 |
7.85 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
13 |
9.19 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
14 |
15.24 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
8 |
7.64 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
5 |
14.44 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
13 |
9.06 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
7 |
9.34 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
46 |
19.24 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
2 |
2.05 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
95 |
23.91 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
104 |
29.48 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
121 |
30.96 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
384 |
184.97 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
501 |
416.2 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
1073 |
608.39 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
95 |
29.31 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
279 |
73.25 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00084
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch02 |
45487032 |
45487195 |
+ |
UCUUCCUGGCUAUAUUCCCU
UGUAAAGUGUCCCUCUUCGC
CGCAUUUGUAGCAUCCCGCU
AUUCCUCCACCGCCUCCCUG
GCUACAUUCCCUUGCGAAAG
AAGGAGGGGGCUGCUACAAA
UGUGGGGAAGAAGGGCAUUU
UGGAAGGGAUUGUAGGCAGA
GAGA |
-91.30 |
NA |
structure |
| SL2.40ch02 |
45483335 |
45483498 |
+ |
UCUUCCUGGCUAUAUUCCCU
UGUAAAGUGUCCUUCUUGUC
CGCAUUUGUAGCAUCCCGCU
CCUCCUCCACCGCCUCCUUG
GCUACAUUCCCUUGUGAAAG
AAGGAAGGGGCUGCUACAAA
UGUGGGGAAGAAGGGCAUUU
UGGAAGGGAUUGUAGGCAGA
GAGA |
-91.80 |
NA |
structure |
|