Tomato miRNA M00089
| sequence | Length | miRNA family | sRNA ID | target |
|---|
| GGGGCAACUUGAGAUCACAUG | 21 | NA |
S18299735 | NA |
Digital expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
11 |
1.07 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
67 |
8.88 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
60 |
7.01 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
35 |
7.54 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
70 |
5.16 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
3 |
2.31 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
2 |
1.52 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
2 |
1.42 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
15 |
14.64 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
1 |
0.98 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
17 |
18.51 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
1 |
1.33 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
2 |
0.5 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
1 |
0.26 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
30 |
8.98 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
83 |
25.12 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
420 |
126.56 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00089
| genome hit of precursor | precursor |
|---|
| sequence ID | start | end | strand |
sequence | folding
energy | miRNA* | structure |
|---|
| SL2.40ch12 |
65125282 |
65125370 |
+ |
GGGGCAACUUGAGAUCACAU
GUUGUCAUUUUUUUCUUUUU
GAUUUGAUUCGAUGAAUCAG
UAUCUCAACAUGUGUUCUCA
GGUUACCCC |
-37.53 |
NA |
structure |
|
