Tomato miRNA M00095
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
64 |
4.72 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
512 |
214.1 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
35 |
35.79 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
469 |
118.05 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
134 |
37.98 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
128 |
32.75 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
1 |
0.83 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
4 |
1.23 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
9 |
2.69 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
4 |
1.21 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
13 |
3.92 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00095
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch01 |
3116752 |
3116834 |
+ |
UCUCUCCAGUCACCUCAUCC
GUAUUUCUCGAAUAGGUUGC
UAAUUCAAGCAUUAGAGAAA
UAUGGAAGAGGUGAUUGGAG
AAA |
-46.40 |
NA |
structure |
|